9700 GOLD 96W GENEAMP PCR SYS

Efficiently perform applications with these PCR tubes and plates, molded from 100% virgin polypropylene. X25 MICRO TUBE THIN WALL PUREPAK 24 X 0.2 WELLS(pack of 25)

For VIC spectral calibration of ViiA™ 7, QuantStudio™ 6 Flex, QuantStudio 7 Flex, or QuantStudio 12K Flex Systems with a Fast 96-well block Fast 96-Well Spectral Calibration Plate

Designed to obtain a fast, reliable, and cost-effective solution for real-time PCR applications without compromising sensitivity, specificity, dynamic range, or efficiency 5000 RXN FAST SYBR GREEN MASTER MIX BULK PACK (1x 50mL) 5000reactions Store at -20 C

Autoclaved to provide a clean, controlled start AUTOCLAVED RXN TUBES W/ CAP,autoclaved, 1000 tubes

0.2 mL individual tubes with attached flat or dome snap shut caps, available in a variety of colors X1000 PCR TUBE 0,2ML DOMED PURPLE(VE=1000Stck.)

Primers for sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2 and for colony screening by PCR. PJET1.2 REVERSE SEQUENCING PRIMER, 24-MER, 5'-D(AAGAACATCGATTTTCCATGGCAG)-3', 10µm, 8.4nmol Store

Increase the efficiency of reactions with these low-profile strip tubes for PCR and qPCR applications. X80 STRIP 12W0,2ML LP DOMED NEUTR

Designed to fit on MicroAmp reaction tubes, tube strips, and 96-well plates X12 MICROAMP, 12-CAP STRIP

Available in full, half, and elevated skirt styles X50 PCR 96-Well plate, Thermowell GOLD, PP, Clear, Half Skirt, Nonsterile, 10/bag

Ambion pUC 19 DNA is digested to completion with Sau3A I 0.5 MG PUC19 DNA - SAU3A I DIGESTED 0.5MG STOREat -20 C

Ideal for use in 0.2mL, 96-well V-bottom thermal cyclers X250 PCR 8-tubes 0.2ml strip w/domed cap, PP,natural, FB-0266

Optimize qPCR with probe chemistry using standard cycling protocols with these ready-to-use qPCR master mixes. MAXIMA PROBE QPCR 4X12.5ML

Optimize SYBR Green chemistry using standard cycling protocols with these colored qPCR master mixes. 1600 RXN ABSOLUTE BLUE QPCR SYBR GREEN FLUORESCEINmix, 1600 x 25µL reactions, supplied in 16 x

Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. T3 PRIMER 24-MER 10UM 4.2NMOL

A highly efficient kit for the simultaneous and seamless assembly of up to 10 DNA fragments, totaling up to 110 Kbp in length, into any vector. GENEART HO GEN ASSY SYS

PCRRÖR TUNN VÄGG 0,5ML KLAR FP=1000

Provides superior nucleic acid quantitation 1 ML SYBR GREEN PCR MASTER MIX, MINI PACK 1MLStore at -20 C

Low profile strip tubes for PCR and qPCR applications. X80 STRIP 12X0,2ML LP NEUTRAL

Everything needed for SYBR Green dye-based PCR amplification and detection in a convenient, single-tube format TF,SYBR GREEN PCR MASTER MIX,

Applied Biosystems™ TaqMan™ Environmental Master Mix 2.0 offers accurate, real-time PCR-based pathogen detection in the presence of high levels of inhibitors. 200 RXN TAQMAN ENVIRONMENTAL 200REACTIONS STOREat -20 C

Optimize high throughput robotic PCR and qPCR applications with these uItra-rigid 384-well PCR plates with poylcarbonate frames and polypropylene wells. X50 PLATE PCR 384 CL WELLS RED CO

!ncorporate high-performance technology for reliable gene expression data from ABI PRISM™ 7300, 7000, 7700 or 7900HT instruments SYBR GREENER QPCR FOR ABI

Sequence DNA fragments inserted into the MCS of various pUC19 based cloning vectors with M13 pUC sequencing primers, single-stranded oligonucleotides. 6 NMOL M13/PUC SEQUENCING PRIMER (-40), 17-MER,5'-d(GTTTTCCCAGTCACGAC)-3', 10µm, 6nmol Store at

96-well semi-skirted PCR plates with a flat deck for improved sealing in PCR and qPCR applications. PCR Plate, 96-well, segmented, semi-skirted

For use with 7900HT and 7500 Fast Real-Time PCR Systems MeltDoctor HRM Calibration Standard

96-well semi-skirted PCR plates with a flat deck for improved sealing in PCR and qPCR applications. X25 THERMOFAST 96X0,2ML MARKIIwith Black Lettering) 25 plates

Optimize robotic applications with these ultra-rigid 96-well PCR plates with U-bottom wells, available in various colors. X25 PLATE PCR 96 WH WELLS GRN COD

Ready-to-use reaction mixes for high-specificity, real-time amplification of cDNA, genomic DNA or plasmid DNA for ABI instruments X100 qPCR supermix with ROX Sybr(r) Store at -20°C

Formulated for maximum specificity and reproducibility X2 Power Up Sybr Master Mix, 1ML