Molecular Biology Reagents and Kits
Thermo Scientific™ Luminaris Color HiGreen qPCR Master Mix, High ROX
Thermo Scientific Luminaris Color HiGreen and Luminaris HiGreen qPCR Master Mixes are universal ready-to-use solutions optimized for qPCR and two-step RT-qPCR. 5000RXN Luminaris Color HiGreen High ROX qPCRMastermix
Thermo Scientific™ 0.2 mL Strip Tubes
Optimize PCR and qPCR with these 0.2 mL strip tubes, available as 8 tubes per strip in several colors or 12 tubes per strip. X120 STRIP 8X0,2ML BLUE 10X12
Fisherbrand™ 96-Well Low-Profile, Skirted PCR Plates
Fit most thermal cyclers X25 Fisherbrand PCR plate 96-wells, full skirt, PP, red - FB-0800/R
Thermo Scientific™ Armadillo™ 384-Well PCR Plates
Optimize high throughput robotic PCR and qPCR applications with these uItra-rigid 384-well PCR plates with poylcarbonate frames and polypropylene wells. X50 PLATE PCR 384 CLR WELLS GRN
Thermo Scientific™ Luminaris Color HiGreen qPCR Master Mix
Thermo Scientific Luminaris Color HiGreen and Luminaris HiGreen qPCR Master Mixes are universal ready-to-use solutions optimized for qPCR and two-step RT-qPCR. 5000RXN Luminaris Color HiGreen qPCR MM (2x)
Fisherbrand™ 0.2mL PCR Tube Strips
Ideal for use in 0.2mL, 96-well V-bottom thermal cyclers X250 PCR 8-tubes 0.2ml strip w/domed cap, PP,natural, FB-0266
Thermo Scientific Pierce™ D-Luciferin
Get convenience and high performance at a low cost in firefly luciferase reporter assays with our D-Luciferin, formulated at greater than 99% purity as both monosodium and monopotassium salts. 1GR D-LUCIFERIN, MONOPOTASSIUM SALT
Thermo Scientific™ Thermo-Fast™ 96-Well Full-Skirted Plates
96-well full-skirted PCR automation compatible plate for use in PCR and qPCR applications. X25 THERMOFAST SK 96X0,2ML GREENgreen (VE=25Stck.)
Thermo Scientific™ Armadillo™ 96-Well PCR Plate
Optimize robotic applications with these ultra-rigid 96-well PCR plates with U-bottom wells, available in various colors. X25 PLATE PCR 96 WH WELLS GRN COD
Thermo Scientific™ 96-Well Non-Skirted Plates
96-well non-skirted plates for use in PCR and qPCR applications. Available with black lettering for improved sample tracking during pipetting. X25 THERMOFAST 96X0,2ML BLACK(VE=25Stck.)
Thermo Scientific™ pJET1.2 Sequencing Primers
Primers for sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2 and for colony screening by PCR. PJET1.2 REVERSE SEQUENCING PRIMER, 24-MER, 5'-D(AAGAACATCGATTTTCCATGGCAG)-3', 10µm, 8.4nmol Store
Thermo Scientific™ 96-Well Non-Skirted Plates, Low Profile
Low profile 96-well plates for use in PCR and qPCR applications. X25 Plate Thermo Scientific Abgene ThermoFast(R)
Thermo Scientific™ Nuclease-free Water
X4 Molecular biology reagents, water, nuclease-fre
Fisherbrand™ Anodized Aluminum Blocks
Useful for a variety of applications in molecular biology, histology, clinical, environmental and industrial settings. Fisherbrand™ Anodized Aluminum Blocks are for use with Fisherbrand Digital Block Heaters.
BLOCK 24 TUBES EPP 1,5ML
Thermo Scientific™ 0.1 mL Individual UTW Tubes
Reduce incubation times during PCR with these ultra-thin wall individual PCR tubes with attached flat caps. PCR TUBE W/CLR CAP,WHITE 960/CS, VE=960 St.
Alfa Aesar™ Water, DEPC-Treated
1LT Water, DEPC-Treated
Eppendorf™ PCR Tubes
Ensure efficient heat transfer to the sample with these tubes, thanks to their thin, even wall thickness and smooth wall surface. Eppendorf™ PCR Tubes are easy to open, but provide tight sealing to prevent evaporation in PCR. X500 Tubes PCR thin-walled 0.5mL (pack of 500)
Eppendorf™ Cable
Cable Eppendorf for mastercycler ep 150cm
Thermo Scientific™ ABsolute™ qPCR Mix, SYBR Green, ROX
Optimized for SYBR Green chemistry and contains all the components necessary to perform quantitative PCR, with the exception of template and primers. AB-1162/b Absolute QPCR SYBR Green Rox (500nm)
Thermo Scientific™ VersiPlate™ 96-well PCR Plates and Frames
Flexible 96-well plates of low profile strip tubes for use in PCR and qPCR applications. VersiPlate, 96-well PCR Plate
Thermo Scientific™ 6X TriTrack DNA Loading Dye
Prepare DNA markers and samples for loading on agarose or polyacrylamide gels with Thermo Scientific™ 6X TriTrack DNA Loading Dye. X5 6X TRITRACK(TM) DNA LOADING DYE 1ML STORE AT-20°C
Eppendorf™ ThermoStat™ C
Use this temperature control device for heating and cooling almost any of your lab vessels. The Eppendorf ThermoStat™ C is the ideal device to accurately set and maintain temperatures. THERMOSTAT C W/O THERMOBLOCK, SMARTBLOCK 220-240V
Eppendorf™ Spacer
SPACER FOR MASTERCYCLER EP, VERSION 384
Eppendorf™ Mastercycler™ PRO
Mastercycler pro, 230V, EU Plug
Eppendorf™ Mastercycler™ PRO S
Mastercycler pro S + Control Panel, 230V EU plug
Thermo Scientific™ Transcription Promoter Sequencing Primers
Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. T3 PRIMER 24-MER 10UM 4.2NMOL
Alfa Aesar™ Water, Endotoxin-free
Chemical Name or Material: Water, Endotoxin-free CAS: 7732-18-5 Molecular Formula: H2O Formula Weight: 18.02 MDL Number: MFCD00011332 Beilstein: 2050024 Merck Index: 14,10039 1LT Water, Endotoxin-free
Fisherbrand™ Anodized Dual Aluminum Blocks
Useful for a variety of applications in molecular biology, histology, clinical, environmental and industrial. Fisherbrand™ Anodized Dual Aluminum Blocks are for use with Fisherbrand Digital Block Heaters.
DUAL BLOCK 96 WELL MICROTITER PLATEor 4 slides corosion resistant anodised aluminium
Thermo Scientific™ 0.5 mL Individual Tubes
Minimize sample loss with the “snap shut” lids on these individual 0.5mL tubes for PCR applications. X1000 PCR TUBE 0,5ML FLAT BLUE(VE=1000Stck.)
Thermo Scientific™ Low Profile Strip Tubes & Caps
Low profile strip tubes for PCR and qPCR applications. X80 STRIP 12X0,2ML LP NEUTRAL
One moment while we fetch your results