Thermo Scientific Luminaris Color HiGreen and Luminaris HiGreen qPCR Master Mixes are universal ready-to-use solutions optimized for qPCR and two-step RT-qPCR. 5000RXN Luminaris Color HiGreen High ROX qPCRMastermix

Optimize PCR and qPCR with these 0.2 mL strip tubes, available as 8 tubes per strip in several colors or 12 tubes per strip. X120 STRIP 8X0,2ML BLUE 10X12

Fit most thermal cyclers X25 Fisherbrand PCR plate 96-wells, full skirt, PP, red - FB-0800/R

Optimize high throughput robotic PCR and qPCR applications with these uItra-rigid 384-well PCR plates with poylcarbonate frames and polypropylene wells. X50 PLATE PCR 384 CLR WELLS GRN

Thermo Scientific Luminaris Color HiGreen and Luminaris HiGreen qPCR Master Mixes are universal ready-to-use solutions optimized for qPCR and two-step RT-qPCR. 5000RXN Luminaris Color HiGreen qPCR MM (2x)

Ideal for use in 0.2mL, 96-well V-bottom thermal cyclers X250 PCR 8-tubes 0.2ml strip w/domed cap, PP,natural, FB-0266

Get convenience and high performance at a low cost in firefly luciferase reporter assays with our D-Luciferin, formulated at greater than 99% purity as both monosodium and monopotassium salts. 1GR D-LUCIFERIN, MONOPOTASSIUM SALT

96-well full-skirted PCR automation compatible plate for use in PCR and qPCR applications. X25 THERMOFAST SK 96X0,2ML GREENgreen (VE=25Stck.)

Optimize robotic applications with these ultra-rigid 96-well PCR plates with U-bottom wells, available in various colors. X25 PLATE PCR 96 WH WELLS GRN COD

96-well non-skirted plates for use in PCR and qPCR applications. Available with black lettering for improved sample tracking during pipetting. X25 THERMOFAST 96X0,2ML BLACK(VE=25Stck.)

Primers for sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2 and for colony screening by PCR. PJET1.2 REVERSE SEQUENCING PRIMER, 24-MER, 5'-D(AAGAACATCGATTTTCCATGGCAG)-3', 10µm, 8.4nmol Store

Low profile 96-well plates for use in PCR and qPCR applications. X25 Plate Thermo Scientific Abgene ThermoFast(R)

X4 Molecular biology reagents, water, nuclease-fre

Useful for a variety of applications in molecular biology, histology, clinical, environmental and industrial settings. Fisherbrand™ Anodized Aluminum Blocks are for use with Fisherbrand Digital Block Heaters.
BLOCK 24 TUBES EPP 1,5ML

Reduce incubation times during PCR with these ultra-thin wall individual PCR tubes with attached flat caps. PCR TUBE W/CLR CAP,WHITE 960/CS, VE=960 St.

1LT Water, DEPC-Treated

Ensure efficient heat transfer to the sample with these tubes, thanks to their thin, even wall thickness and smooth wall surface. Eppendorf™ PCR Tubes are easy to open, but provide tight sealing to prevent evaporation in PCR. X500 Tubes PCR thin-walled 0.5mL (pack of 500)

Cable Eppendorf for mastercycler ep 150cm

Optimized for SYBR Green chemistry and contains all the components necessary to perform quantitative PCR, with the exception of template and primers. AB-1162/b Absolute QPCR SYBR Green Rox (500nm)

Flexible 96-well plates of low profile strip tubes for use in PCR and qPCR applications. VersiPlate, 96-well PCR Plate

Prepare DNA markers and samples for loading on agarose or polyacrylamide gels with Thermo Scientific™ 6X TriTrack DNA Loading Dye. X5 6X TRITRACK(TM) DNA LOADING DYE 1ML STORE AT-20°C

Use this temperature control device for heating and cooling almost any of your lab vessels. The Eppendorf ThermoStat™ C is the ideal device to accurately set and maintain temperatures. THERMOSTAT C W/O THERMOBLOCK, SMARTBLOCK 220-240V

SPACER FOR MASTERCYCLER EP, VERSION 384

Mastercycler pro, 230V, EU Plug

Mastercycler pro S + Control Panel, 230V EU plug

Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. T3 PRIMER 24-MER 10UM 4.2NMOL

Chemical Name or Material: Water, Endotoxin-free CAS: 7732-18-5 Molecular Formula: H₂O Formula Weight: 18.02 MDL Number: MFCD00011332 Beilstein: 2050024 Merck Index: 14,10039 1LT Water, Endotoxin-free

Useful for a variety of applications in molecular biology, histology, clinical, environmental and industrial. Fisherbrand™ Anodized Dual Aluminum Blocks are for use with Fisherbrand Digital Block Heaters.
DUAL BLOCK 96 WELL MICROTITER PLATEor 4 slides corosion resistant anodised aluminium

Minimize sample loss with the “snap shut” lids on these individual 0.5mL tubes for PCR applications. X1000 PCR TUBE 0,5ML FLAT BLUE(VE=1000Stck.)

Low profile strip tubes for PCR and qPCR applications. X80 STRIP 12X0,2ML LP NEUTRAL